Functional abnormality of the inner ear

0011389

Normal Case/Contol ^ⓘ

Sibling Case/Control ^ⓘ

Links

Sex Split

Interactive Plot

Statistics

Case	Control
25685	434509

Phenotype Definition

An abnormality of the function of the inner ear. [DDD:dfitzpatrick]

Phenotype Comment

The inner ear comprises the cochlea, three semicircular canals and the vestibule (labyrinth), and is directly responsible for hearing. Additionally, the vestibule and semicircular canals function to maintain balance or equilibrium.

Top SNP Information

Location	SNP	Gene	Ref>Alt	Alt in Case	Alt in Control	Chi-square	P-value	Odds ratio
chr14:69044554	rs79071597	RAD51B	C>T	15701	255216	31.84	1.672e-08	1.057
chr12:111872722	rs12371484	SH2B3	T>C	3267	50298	28.48	9.483e-08	1.104
chr12:112277084	rs12370770	-	C>T	3350	51735	27.57	1.514e-07	1.101
chr6:396321	rs12203592	IRF4	C>T	11713	189492	26.6	2.505e-07	1.057
chr8:124758189	rs4870865	-	G>A	2627	48899	24.55	7.228e-07	0.9033
chr15:48426484	rs1426654	SLC24A5	A>G	1351	26175	24.53	7.317e-07	0.8695
chr4:184973980	rs7437707	-	G>A	22804	375423	24.38	7.888e-07	1.045
chr10:45243171	rs10900107	-	T>C	1208	23537	23.73	1.107e-06	0.8648
chr15:48392165	rs1834640	-	A>G	1571	30053	23.56	1.21e-06	0.8804
chr7:104745295	rs2299297	KMT2E	C>T	15785	276117	23.5	1.252e-06	0.954
chr14:69034682	rs999737	RAD51B	C>T	13500	220023	23.07	1.562e-06	1.05
chr6:421281	rs62389423	-	G>A	9564	154472	22.61	1.981e-06	1.057
chr6:170242949	rs9396958	-	T>C	763	15351	22.41	2.198e-06	0.8381
chr3:197544199	Affx-52364725	LRCH3	ACGTGTGTGTGTGTATTTTGTGTGTGTGTG>A	7751	124462	22.16	2.507e-06	1.061
chr8:92158920	rs77088745	LRRC69	A>G	3914	61312	22.15	2.52e-06	1.084
chr8:145639681	rs1871534	SLC39A4	G>C	869	17276	22.11	2.57e-06	0.8482
chr2:164278497	rs6743625	-	C>G	1871	35268	21.87	2.912e-06	0.8933
chr7:157186627	rs917738	DNAJB6	T>C	21663	356525	21.83	2.972e-06	1.044
chr9:26273358	rs990328	-	A>G	3152	57847	21.77	3.069e-06	0.9158
chr19:49208865	rs504963	FUT2	A>G	25264	436661	21.76	3.087e-06	0.9596
chr12:111872722	rs12371484	SH2B3	T>C	3236	49770	29.19	6.56e-08	1.106
chr12:112277084	rs12370770	-	C>T	3298	51032	26.39	2.783e-07	1.1
chr6:396321	rs12203592	IRF4	C>T	11563	187352	25.68	4.032e-07	1.057
chr14:69044554	rs79071597	RAD51B	C>T	15220	248641	24.55	7.231e-07	1.051
chr3:197544199	Affx-52364725	LRCH3	ACGTGTGTGTGTGTATTTTGTGTGTGTGTG>A	7335	117451	23.66	1.15e-06	1.065
chr1:92395927	rs7556373	-	T>C	7660	123031	22.65	1.944e-06	1.063
chr3:197480213	rs6583253	FYTTD1	C>T	7356	118021	22.62	1.973e-06	1.064
chr1:43459636	rs1198257	-	A>G	4261	67061	22.53	2.067e-06	1.081
chr4:184973980	rs7437707	-	G>A	21806	359484	22.0	2.725e-06	1.044
chr7:104635467	rs79653827	-	T>C	3831	69810	21.77	3.066e-06	0.9227
chr6:421281	rs62389423	-	G>A	9424	152441	21.51	3.524e-06	1.056
chr16:69951291	rs904809	WWP2	G>A	16070	280188	20.98	4.645e-06	0.9561
chr16:69948949	rs4985378	WWP2	A>G	15876	276987	20.86	4.943e-06	0.9561
chr4:7792662	rs877707	AFAP1	T>C	5594	89185	20.84	4.99e-06	1.069
chr6:25842951	rs1408272	SLC17A3	T>G	4282	67602	20.74	5.251e-06	1.078
chr6:98979105	rs9388545	-	G>A	872	12604	20.48	6.024e-06	1.173
chr1:235313921	rs74868495	RBM34	G>A	7835	139018	20.31	6.584e-06	0.9447
chr19:58218846	rs4801515	ZNF551	A>G	9203	148980	20.23	6.862e-06	1.055
chr8:139152091	rs7828715	FAM135B	G>A	18863	310555	20.18	7.034e-06	1.043
chr6:25918225	rs80215559	SLC17A2	T>C	4150	65545	19.96	7.913e-06	1.077

Location	SNP	Gene	Ref>Alt	Alt in Case	Alt in Control	Chi-square	P-value	Odds ratio
chr12:125028111	rs114932740	NCOR2	G>A	2548	152	27.46	1.601e-07	0.6369
chr15:99341797	rs76022031	IGF1R	A>G	1737	111	26.51	2.62e-07	0.5988
chr1:164603787	rs1770550	PBX1	C>T	24104	829	25.71	3.964e-07	1.263
chr9:79842262	rs116915082	VPS13A	A>C	1032	73	25.44	4.554e-07	0.5418
chr9:80011268	rs117257478	VPS13A	G>A	939	68	24.99	5.771e-07	0.5336
chr3:88433354	rs75385467	CSNKA2IP	A>G	1547	99	23.65	1.153e-06	0.5997
chr3:130114082	rs1353613	COL6A5	C>G	561	45	22.77	1.825e-06	0.4813
chr1:169663079	rs2298902	C1orf112	G>T	5199	268	21.89	2.891e-06	0.731
chr13:49449719	rs118148261	-	C>T	713	53	21.3	3.931e-06	0.5199
chr1:164583573	rs2800785	PBX1	G>C	19749	671	20.85	4.974e-06	1.246
chr5:146581206	rs116805384	-	C>T	654	49	20.25	6.796e-06	0.5156
chr2:30574213	rs113207583	-	G>T	571	44	19.84	8.403e-06	0.5012
chr18:41612379	rs76047097	-	G>A	1840	110	19.62	9.444e-06	0.6418
chr3:193758849	rs115507421	-	T>C	1462	91	19.46	1.026e-05	0.617
chr18:41737085	rs113495584	-	T>C	1955	115	19.46	1.029e-05	0.6487
chr7:118216637	rs2214157	-	T>C	7674	229	19.43	1.044e-05	1.368
chr23:63412690	rs34677493	AMER1	A>C	168	18	19.15	1.207e-05	0.3521
chr5:163505869	rs13173656	-	C>T	4990	254	18.97	1.325e-05	0.7419
chr9:124330970	rs10985320	DAB2IP	T>C	8564	262	18.83	1.427e-05	1.338
chr3:88615092	rs114326243	-	C>T	618	46	18.74	1.502e-05	0.5182

Associated Diseases ^ⓘ

ID	Name	Top Correlation
ICD: F100	Acute intoxication	3/20
ICD: H919	Hearing loss, unspecified	3/20
ICD: R268	Other and unspecified abnormalities of gait and mobility	1/20

ID	Name	Top Correlation
ICD-10: G431	Migraine with aura [classical migraine]	0/20
ICD-10: G438	Other migraine	0/20
ICD-10: G439	Migraine, unspecified	0/20
ICD-10: H358	Other specified retinal disorders	0/20
ICD-10: H544	Blindness, one eye	0/20
ICD-10: H728	Other perforations of tympanic membrane	0/20
ICD-10: H810	Meniere's disease	0/20
ICD-10: H811	Benign paroxysmal vertigo	0/20
ICD-10: H812	Vestibular neuronitis	0/20
ICD-10: H830	Labyrinthitis	0/20
ICD-10: H901	Conductive hearing loss, unilateral with unrestricted hearing on the contralateral side	0/20
ICD-10: H902	Conductive hearing loss, unspecified	0/20
ICD-10: H903	Sensorineural hearing loss, bilateral	0/20
ICD-10: H904	Sensorineural hearing loss, unilateral with unrestricted hearing on the contralateral side	0/20
ICD-10: H905	Sensorineural hearing loss, unspecified	0/20
ICD-10: I700	Atherosclerosis of aorta	0/20
ICD-10: J61	Pneumoconiosis due to asbestos and other mineral fibres	0/20
ICD-10: L918	Other hypertrophic disorders of skin	0/20
ICD-10: R066	Hiccough	0/20
ICD-10: R278	Other and unspecified lack of coordination	0/20
ICD-10: R42	Dizziness and giddiness	0/20
ICD-10: Y450	Opioids and related analgesics	0/20